DNA is an abbreviation of Deoxyribo Nucleic Acid, a for live very important molecule. A DNA molecule consists of two long strands that twist around eachother like a spiral staircase. That is why the molecule is called a double helix. Each strand consists of the backbone of ribose (a sugar) together with phosphate groups and nitrogen bases. There are 4 different nitrogen bases: Adenine (A), Thymine (T), Cytosine (C) and Guanine (G). These bases are often called after their first letter. The A in a strand can form bonds with the T in the opposite strand and the G can form bonds with the C. They form basepairs. This is why the strands are always each others mirror image, each others complement. They are called complementary strands: ATGCGTGCAATGTTTACGCGTAAAGCGTGCACGTTAGAGTACGTGCAGT ||||||||||||||||||||||||||||||||||||||||||||||||| TACGCACGTTACAAATGCTCATTTCGCACGTGCAAGCTCATGCACGTCA The order in which the bases are present in the DNA forms a code which determines genetic information. Like notes on a piece of music form a melody, the letters A, C, G and T for the foundation of genetic properties. So despite there are only 4 code letters, the possible lettercombinations of a piece of DNA of just hundred of these basepairs is very large. And when considering the fact that the human DNA consists of 6 million basepairs, DNA is very unique for a person.