| |
 |
 |
|
| |
 |
 |
|
| |
 |
 |
|
| |
 |
 |
|
| |
 |
 |
|
| |
 |
 |
|
| |
 |
 |
|
| |
 |
 |
|
| |
| Marijke van der Sijde, © 2012 |
|
| |
|
|
There are 20 different amino acids. Each amino acids is coded by a 'word' of 3 bases. Such a word is called a codon. Because there are many different combinations of 3 bases there is a clear overview table of all the codons. All amino acids also have a 1-letter code, not shown in the table. There is 1 codon that codes a starting-signal in a protein, that is the codon for the amino acid Methionine (Met): AUG. And there are 3 codons that give a stop-signal. The nucleotide sequence between the startcodon and the stopcodon is eventually translated into a protein.

The translation
To go from nucleotide sequence to proteins the DNA must first be translated to a structure that is similar to DNA. This is RNA (RiboNucleicAcid) and it has almost the same structure as DNA. There is an important difference between DNA and RNA: RNA is single stranded, in contrary to DNA, which is double stranded. And besides that RNA has in stead of the base Thymidine (T) the base Uracil (U). The function of RNA is to transport the genetic material and thus is a sort of messenger. That is why the molecule is also called messenger RNA (mRNA). mRNA has to take the genetic information from inside the nucleus to the outside, so the translation into protein can continue. This happens on ribosomes, a compartment of the cell. The ribosomes read the nucleotide sequence between the startcodon and the stopcodon and translate this into an amino acid sequence:
DNA ATGCGTGCAATGTTTACGCGTAAAGCGTGCACGTTAGAGTGA
TACGCACGTTACAAATGCGCATTTCGCACGTGCAATCTCACT
RNA AUGCGUGCAAUGUUUACGCGUAAAGCGUGCACGUUAGAGUGA
Protein Start - R-A-M-F-T-R-K-A-C-T-L-E - Stop
This sequence forms a protein with a certain genetic property. For instance a protein that codes for eyecolor or bloodgroup.
|
|
|
|